Relatos en la Isla Tintero

Isla Tintero es el lugar donde cualquiera que haya sentido alguna vez la llamada de las palabras debe parar al menos una vez en la vida.

Ciencia para escritores: las mutaciones

¡Buenas a todos! Hoy vamos a hablar de un tema apasionante. Antes de empezar, os aviso que el artículo es bastante exhaustivo, pero que aún me habría gustado tocar más temas. Estoy pensando en hacer un artículo ampliado y colgarlo en algún sitio para que lo podáis descargar y leerlo entero.

las mutaciones

Podríamos ponernos a contar los libros o películas en los que aparecen mutantes y no acabaríamos. Sin duda, la más conocida es la saga de X-Men, y creo que esas películas han inducido a confusión a una (o incluso varias) generaciones. En este artículo quiero hablaros un poco de cómo funciona la genética, para que podáis entender qué son las mutaciones de verdad. También hablaremos de cómo podemos generar mutaciones para crear humanos con características especiales… E incluso superhumanos.

Lo básico de genética

Para los que sepáis algo de genética: saltaos estas partes e iros directamente a lo interesante.

Empecemos por el principio. Dentro de cada célula que compone a un ser vivo encontramos el ADN, es decir, el material genético, que son básicamente las instrucciones para que la célula funcione correctamente y cumpla con su papel.

El ADN codifica instrucciones porque está formado por nucleótidos que se unen entre ellos igual que unas cuantas perlas se unirían entre ellas para hacer un collar de perlas. Existen cuatro tipos de nucleótidos diferentes, que son como letras y a las que llaman A, C, G y T.

Por tanto, al leer el ADN, lo que se lee es una secuencia tal que: AGTGTTAAGCCGCGTCTAGACACGTCGAAATTAAGCCAC, por ejemplo. ¿Y qué sentido tiene?

El sentido que tiene todo esto es que existe un código genético que permite traducir grupos de tres nucleótidos, por ejemplo AAT, a aminoácidos, que son las pequeñas unidades que forman las proteínas (igual que los nucleótidos forman el ADN). De las proteínas podría decirse que son las piezas más importantes de la célula: ellas hacen que todo esté donde debería estar y que funcione correctamente. Si fallan ellas, falla todo.

Un gen se puede definir como un trozo de ADN que codifica para una determinada proteína. Es decir, si cogemos los nucleótidos que forman un gen y los agrupamos de tres en tres, cada triplete se corresponde con un determinado aminoácido y al final deberíamos tener una proteína perfectamente funcional.

Aquí podéis verlo en esquemita. Lo que está a la derecha es el código genético: podéis ver con qué aminoácido se corresponde cada triplete. Lo de que aparezca la U en lugar de la T es porque antes de pasarlo a proteínas se pasa a otro tipo de material genético que se llama ARN mensajero y que cambia la T (timina) por U (uracilo). Sin embargo, esto no es importante para lo que nos ocupa, así que no os deis mal.

Si os han quedado dudas de esta parte, decídmelo e intentaré resolvéroslas. No estoy acostumbrada a explicar de forma tan simple este tipo de conceptos.

¿Qué son las mutaciones?

Una mutación es cualquier cambio en la secuencia de nucleótidos o en la organización del material genético. Hay unas cuantas cosas sobre las mutaciones que tienen que quedar claras. Primero: las mutaciones no siempre producen efectos en el portador. Puede ser que un gen mutado dé lugar a una proteína igual (si os fijáis en la foto del código genético, hay tripletes que dan el mismo aminoácido, este precisamente es un mecanismo para disminuir los efectos de las mutaciones). Por otro lado, puede haber mutado un gen que no se expresa en esa célula o que la proteína mutada sea tan parecida que los efectos no se noten nada.

Segundo: no todas las mutaciones se transmiten a la descendencia. Por lógica, a nuestros hijos solo les pasamos los genes que tenemos en el óvulo o en el espermatozoide, ya que a partir de estas células surgirá el hijo entero. Así que, si de repente sufrimos una mutación que solo nos afecta a una parte de nuestras células, pongamos, las del brazo, nuestros hijos no pueden tener la mutación y se perderá con nosotros.

Tercero: las mutaciones se producen al azar. Es decir, no existe un mecanismo que diga “Uy, detecto que este humano nada mucho, voy a hacer que le crezcan membranas en los dedos cual ornitorrinco”. No. Si una especie nada mucho es probable que al cabo de miles de años esté mejor adaptada a la natación, pero eso ocurre lentamente a lo largo de muchos años y se debe a la selección natural (de la que hablaremos otro día).

La mayoría de las mutaciones que se producen son perjudiciales porque dan lugar a una proteína que no funciona. En esos casos, el individuo mutado puede llegar a morir o ver su vida muy dificultada: esas mutaciones no llegan a extenderse mucho porque los mutantes en la mayoría de los casos no llegan a pasárselas a la descendencia. Otras mutaciones son neutras, no le causan al individuo ni daño ni perjuicio. Por último, un pequeño grupo de proteínas son beneficiosas y ayudan al individuo a adaptarse mejor al entorno.

Este es otro concepto importante: no hay mutaciones buenas y malas en términos absolutos. Está claro que una mutación que haga que una proteína vital no funcione es mala para el individuo, pero otras muchas dependen del entorno. Volvamos al ejemplo de las membranas en los dedos para nadar. Pongamos que uno de ellos tiene membranas: esto le otorga una ventaja sobre el resto, ya que podrá nadar más rápido y posiblemente conseguir más comida. Sin embargo, si llegara un momento en el que la especie se desplazara fuera del agua, o se secara, el membranoso estaría en desventaja, porque seguramente le costaría más manipular ciertos objetos. Esto puede aplicarse a casi todas las mutaciones, solo hay que pensar con lógica cómo sería ante cada situación.

Otro ejemplo es el de la anemia falciforme: los glóbulos rojos están deformes y pueden captar menos oxígeno. Sin embargo, esta mutación está presente en África en mucha gente, ya que protege contra la malaria (al protozoo que la causa no le gustan mucho). Como veis, una mutación que en Europa es perjudicial, en gran parte de África es beneficiosa.

También hay que hablar de cómo se producen las mutaciones. Hay diversas causas, y la más sencilla es el azar. Con tanto ajetreo, a veces los sistemas de replicación del ADN fallan y dan lugar a mutaciones que no se corrigen después. Por otro lado, hay factores que afectan al ADN provocando fallos también: el tabaco, los rayos UVA, compuestos químicos como el ácido nitroso, y agentes biológicos, como los virus (de ellos hablaremos luego).

Pero no todo vale…

Ahora llega el momento en el que destrozo vuestros corazones y os digo que todo lo que teníais en mente no vale. Voy a intentar hacerlo con suavidad, agarraos.

La mayoría de las cosas que nos interesan para mutar no dependen de un gen, sino de conjuntos de genes que se coordinan para dar lugar a rasgos externos. En humanos, muchas enfermedades son monogénicas, por ejemplo, el albinismo o el daltonismo: un fallo en un solo gen hace que la persona esté enferma. Pero muchísimas características de las personas, muchas de las más fáciles de ver, funcionan por la herencia poligénica, es decir, dependen de varios genes. ¿Ejemplos? La altura, si tu padre es altísimo y tu madre enana, lo más probable es que tengas una altura media; el color de la piel, y por eso los hijos de negros y blancos suelen ser mulatos; la inteligencia, el peso, formas de comportamiento…etc.

Como veis, no vais a conseguir que vuestro personaje sea de repente super inteligente con solo manipular un gen. Si queréis que tenga superfuerza, os va a costar bastante más que una sola manipulación. En el caso de los X-Men, por ejemplo, Logan tiene poderes regenerativos, es decir, que puede curarse las heridas muy rápido. Pero no existen un gen de curar heridas; para conseguirlo tienen que estar mutados los genes de división celular, coagulación sanguínea y unos poquitos más. Si quisiéramos un mutante como Logan, tendríamos que mutar varios de sus genes, de una forma específica (no al azar) para que las proteínas implicadas en la regeneración funcionaran más rápido de lo normal. Como veis, es un poco complicado que alguien tenga esta mutación por azar ¿no?

La única solución a esto es, como ya he mencionado, manipular los genes de alguien a propósito. Actualmente, las técnicas para desarrollar esto están aún en pañales, pero ya tienen a los científicos de todo el mundo poniéndoles el ojo encima. No sé si os sonará la CRISPR, pero si no, después os hablaré un poco de ella y de cómo manipular genes.

Sin embargo, sí que hay mutaciones un poco más complejas que podrían dar lugar a cambios mucho más importantes. Por ejemplo, se cree que la fusión de dos cromosomas pequeños en simios para dar uno grande fue lo que provocó muchas de las diferencias entre nuestro género y los demás. Investigando, está claro que mutaciones pequeñas pueden llegar a causar cambios muy grandes, pero la mayoría tienen que ver sobre todo con la adaptación al entorno, y estos cambios se hacen patentes sobre todo al cabo de varias generaciones. Como prueba, este artículo.

En resumen, mi consejo es que no os motivéis demasiado con las mutaciones producidas al azar, pues no os va a resultar fácil que todo cuadre y sea creíble. Si queréis mutantes, es mejor que sean fabricados por las hacendosas manos de algún científico o corporación de excéntricos. Y bueno, ahora mismo os hablo sobre ello.

Provocando mutaciones

Esta es la parte que interesará a muchos. Sí, las mutaciones pueden llevarse al terreno del laboratorio (y de hecho se hace) para conseguir seres vivos con características diferentes. Antes de seguir, dejadme que os diga que hay dos formas de hacerlo. La primera es a lo bruto: se somete a los organismos a agentes mutágenos, como radiaciones, para que sufran mutaciones aleatorias, y después se eligen las que nos interesan. Esto puede estar bien con bacterias o quizás moscas, pero definitivamente, no nos vale con humanos ni nada por el estilo.

La segunda forma es estudiando bien el genoma de la persona y la composición de las proteínas, para averiguar los cambios que tenemos que hacer y los nucleótidos que hay que tocar para llevarlos a cabo. Sin lugar a dudas, es mucho más laboriosa, y aunque carece del elemento sorpresa de la anterior, los resultados suelen ser mejores.

Vamos a hablar ahora de la ingeniería genética y de algunas de las técnicas que podrían usarse. Una de las más básicas es la tecnología del ADN recombinante, que simplemente consiste en combinar un trozo de ADN de un organismo con el de otro. Esta técnica no es nada nuevo, por ejemplo, hace tiempo que se pueden combinar genes de proteínas normales con un gen de medusa que las hace fluorescentes, así salen proteínas fluorescentes que se ven mucho mejor al microscopio electrónico. Sin embargo, lo de meter genes de unas especies en otras no siempre es lo que queremos: a veces solo necesitamos modificar lo que ya tenemos.

Para ello existen diversas técnicas, pero la más famosa y la que posiblemente dé más que hablar es la CRISPR. Sin entrar en detalles, se trata de una técnica que permitiría editar el ADN de forma muy exacta, además de rápido y barato. Al principio se vio que CRISPR (acabo de leer que se pronuncia crísper, aunque yo siempre le había llamado cris-pe-erre) podía servir para cortar genes indeseables, por ejemplo, si unos padres veían que su hijo era susceptible de tener una enfermedad dependiente de un gen, se podría eliminar ese gen de la primera célula del hijo antes de que llegara a convertirse en embrión y estar enfermo.

Esto ya supone un gran paso adelante, pero es que CRISPR también podría servir para sustituir genes en vez de solo cortarlos. Como podéis suponer, esto sí que sería una revolución, ya que tiene un potencial enorme: desde bebés a la carta a superhumanos.

Sin embargo, tengo que decir que esto no es algo que vaya a ocurrir de hoy a mañana. En primer lugar, muchos laboratorios están trabajando ya en ello, obteniendo diversos resultados, y es difícil predecir lo que va a pasar porque en cualquier momento se podría hacer un descubrimiento que cambiara el curso de la investigación. Por otro lado, si se quiere seguir avanzando en las investigaciones con humanos, hay que dejar de usar ratones y usar eso, humanos. Pero como ya he mencionado en algunas ocasiones, esto no es sencillo. La mayoría de los gobiernos, por no decir todos, tienen unas normas muy estrictas en lo que respecta a la investigación con humanos, así que antes de hacer nada, lo primero que tendría que ocurrir es que se normalizara todo este asunto. Viendo al ritmo que va el papeleo, queda bastante claro que va a tardar.

Además, CRISPR no va a ser una técnica que esté lista de hoy para mañana. Se va a ir desarrollando poco a poco, o eso creo. Las modificaciones que permitirá, pongamos, dentro de 10 años, no son las que permitirá dentro de 30 (igual me estoy columpiando con esto de los años, no soy muy buena calculando, pero contando con el desplome de la Ley de Moore, quién sabe).

Mi recomendación es que antes de plantear nada que incluya seres genéticamente modificados, penséis qué técnica se ha usado para hacerlos, lo avanzada que está y si se ha podido conseguir. La mayoría de las cosas se pueden justificar fácilmente con un laboratorio de por medio, pero es necesario tenerlo en cuenta.

Y ahora, aparte de laboratorios, quiero hablaros de otros agentes mutágenos y lo que pueden causar.

Las radiaciones como agentes mutágenos

Todos hemos visto alguna vez ejemplos de las mutaciones provocadas por la radiación. Chérnobil es un buen ejemplo de ello, y posiblemente el más visual. Otro es el de nuestras madres diciéndonos que nos pongamos crema de sol o tendremos cáncer de piel, o el de los protectores de plomo que tenemos que ponernos cuando nos hacemos una radiografía.

Está claro que hay diferentes tipos de radiaciones, con distintos orígenes y, por supuesto, con distintos efectos en nuestro cuerpo. Los rayos UVA pueden afectar a nuestro ADN, causando mutaciones puntuales en las células, que pueden llevar a la muerte celular o incluso al cáncer. Esto se debe a que cambia la expresión genética de la célula con lo que de repente empieza a dividirse sin control, entre otras cosas, que son lo que lleva al cáncer.

Los rayos X pueden causar mutaciones puntuales también (pero en mayor medida, porque son más penetrantes), así como daños cromosómicos. Los daños cromosómicos son mutaciones no en un gen, sino en trozos de cromosomas (o incluso en cromosomas enteros). Como podéis suponer, sus efectos son muchísimo más graves, porque no afectan a un solo gen, sino a muchos. Una de las cosas más peligrosas del daño cromosómico es que ocurran en las células precursoras de los gametos, es decir, las que dan lugar al óvulo o al espermatozoide. Pongamos que un hombre tiene en sus espermatozoides una mutación de este tipo. Él no sufriría ningún efecto ¿por qué iba a hacerlo si sus espermatozoides simplemente están ahí sin hacer nada?

Sin embargo, en el momento que quiera tener un hijo y esos espermatozoides con defectos en los cromosomas se junten con un óvulo normal, queda claro que su descendiente no va a tener tanta suerte como él. El embrión tendrá fallos en los cromosomas, con diferentes efectos dependiendo del tipo de mutación. Es difícil predecir de antemano los síntomas que tendrá, pero ya os adelanto que muchos bebés que tienen lo que se llama “aberraciones cromosómicas” no llegan a nacer o bien mueren antes de alcanzar el año. Otros viven más, como por ejemplo, las personas con Síndrome de Down, que tienen tres cromosomas en el par 21, en lugar de eso, un par.

Nota: es importante que os quedéis con la idea de que no solo las radiaciones pueden causar este tipo de mutaciones. Hay muchas más causas, pero este me parecía un lugar tan bueno como otro cualquiera para hablar de las mutaciones cromosómicas.

Alguno aquí se estará preguntando ya por los desastres en centrales nucleares. Sí, un buen escenario para una novela es una central nuclear destruida, alrededor de la cual se apiñan grupos de mutantes que ocultan entre sus deformidades secretos incognoscibles…

En las centrales nucleares se emite radiación gamma (aparte de otros contaminantes que tienen también sus efectos en el cuerpo), que es muy penetrante. Puede causar daños a la propia persona que está en contacto con ella, pero también causar deformidades y mutaciones en sus descendientes, puesto que altera el ADN. Aquí es importante que recordéis que las mutaciones se van a producir al azar, por tanto, la gran mayoría serán negativas. Pensadlo, si cogéis algo que ya funciona bien (como es en este caso el ADN) y le hacéis muchos cambios aleatoriamente ¿cuál es la probabilidad de que acabe funcionando mejor que al principio? Ya os lo digo yo: poca.

Por otro lado, si ocurriera una mutación beneficiosa para ellos en ese entorno (o incluso puede que neutra), qué se yo, mayor resistencia al frío, inmunidad a algunas enfermedades, o cualquier cosa por el estilo, acabarían pasándosela a sus hijos y estos a los suyos, y así sucesivamente hasta que todos en la comunidad lo tuvieran. Aquí ya entraría la diferencia entre caracteres dominantes y recesivos, pero bueno, eso para otra lección.

Resumen de este apartado: cuidado con las mutaciones por radiación. Sí que puedes usarlas para darle superpoderes a alguien, pero me parece un recurso un poco cogido con pinzas.

 

Virus y mutaciones

En esta parte os quiero hablar de un recurso que también se ha usado en la ciencia ficción para provocar mutaciones: los virus. Como sabréis (o si no sabéis, miradlo en esta entrada) los virus infectan a las células introduciendo dentro de ellas su material genético. Hay virus que se limitan a dejarlo por ahí rondando y a crear más copias de sí mismos rápidamente, pero otros siguen una estrategia llamada ciclo lisogénico que nos interesa más.

Cuando ocurre este tipo de ciclo, el material genético del virus se integra dentro del material genético de la célula, como si fuera un trozo más de ADN y se queda ahí hasta que por algún tipo de estímulo, se sale y comienza a fabricar copias de virus. Como es lógico, mientras el ADN del virus está camuflado con el de la célula, cada vez que esta se divida en dos, pasará el ADN viral a sus hijas. Por tanto, al cabo de un tiempo puede haber muchas células infectadas a la vez. De hecho, si infectáramos con un virus a la primera célula que compone a un ser vivo, es muy probable que al final, todas las células de su cuerpo estuvieran infectadas.

Lo que a nosotros nos interesa de esto es que podríamos usar el mecanismo de infección que tiene el virus para insertar secuencias de genes en las células que nos interesen. De hecho, esta técnica ya se puede usar, por supuesto, con virus modificados que no vayan a matar a la célula después, porque si no, no sirve de nada (se llaman vectores virales).

Creo que el uso de vectores virales es algo que actualmente solo se usa con células en ambiente de laboratorio, pero quizás en un futuro pueda usarse como ahora se usan las cremas. Por ejemplo, podrías infectarte las manos con virus que las hicieran resistentes al calor, para poder sacar la bandeja del horno sin quemarte. Igual que un virus te puede afectar al sistema digestivo o al respiratorio según qué tipo de virus sea, también te podrías infectar tú esas partes para crearte mutaciones que te beneficiaran.

Este recurso también se puede usar en la ciencia ficción (aunque os aviso, lo del párrafo anterior ya es especulación mía) porque tiene una diferencia con los métodos anteriores: es algo que puedes usar en tu propio beneficio. Es decir, no se trata de crear bebés mutados para el futuro, se trata de ti y de ahora: las posibilidades son mayores y más divertidas.

De hecho, por lo que he podido ver, en el juego “Bioshock” puedes inyectarte plásmidos en los brazos para tener más capacidades. La idea no es mala, ya que, como acabo de explicar, no es descabellado pensar que algo similar pudiera hacerse (habría que tener en cuenta posibles efectos adversos, cuánto tarda en hacer efecto y cuán eficaz es, pero bueno). Sin embargo, el término no está muy bien elegido, ya que el ADN viral posiblemente fuera más eficaz que los plásmidos para esto (quien no sepa qué es un plásmido, que se pase por aquí).

 

Conclusión

Como habéis visto, hay muchísimas cosas que podéis usar en relación con las mutaciones. Para mí, lo importante es que os quedéis con que las mutaciones son al azar, y también con los diferentes métodos que hay para tener bebés mutantes. También quiero que os deis cuenta de que las mutaciones, al contrario de lo que aparece en la mayoría de las películas, no son algo afortunado, que otorga al que las posee un fantástico don. Incluso las mutaciones que a primera vista podrían ser beneficiosas, como la polidactilia (tener seis o más dedos) hacen que el mutante esté apartado, ya que el mundo no se hace pensando en ellos (¿dónde se comprarían los guantes?). Tenéis que pensar en todas las posibles ventajas y desventajas, aunque no parezcan obvias.

Además, si estáis pensando en dotar a algún personaje con superpoderes derivados de la mutación y queréis mantener el realismo, os recomiendo que primero penséis bien lo que es posible y lo que no. Por ejemplo, en este artículo, Psiquiatraca explica por qué un solo superhéroe no puede tener visión de Rayos X. Seguro que pensando un poco encontráis cosas parecidas.

Si os ha quedado alguna duda o no estáis seguros acerca de algo, siempre podéis preguntarme en los comentarios e intentaré contestar lo mejor posible. Espero que el artículo os haya aclarado cosas, dado ideas o al menos, interesado. Y recordad, si os interesa algún tema científico, decídmelo e intentaré hablar sobre él. Dicho esto, nada más salvo una cosa:

¡ESCRIBID Y DIBUJAD PARA EL CONCURSO, AHORA!

Y bueno, hasta el próximo día 😀

Anuncios

14 comentarios el “Ciencia para escritores: las mutaciones

  1. Blas E. Cabanilles
    septiembre 4, 2016

    Hoy ha sido todo muy loco. Demasiadas privaciones. Prefiero un pacto con el lector y seguir disfrutando de Superman y los X-men xD.
    P.S.: Eso de los virus para sacar la bandeja del horno me lo apunto. :’D

    Le gusta a 1 persona

    • soyperry
      septiembre 4, 2016

      Bueno, Blas, qué puedo decirte. Es mi deber como científica velar por la veracidad de las publicaciones jajaja.
      ¡Un abrazo!

      Le gusta a 1 persona

  2. anakatzen
    septiembre 5, 2016

    Por fin alguien hace una entrada como esta. He leído un montón de libros cuyos argumentos dependen mucho de seres humanos mutados y los autores no tienen la más mínima idea de cómo funciona la genética. Oye, si te vas a meter en un tema tan complejo, al menos deberías saber lo básico.

    Por cierto, el canal de Youtube In a Nutshell sacó un video sobre CRISPR que tiene subtítulos en español y todo. No sé si lo habrás visto: https://www.youtube.com/watch?v=jAhjPd4uNFY

    Le gusta a 1 persona

    • soyperry
      septiembre 7, 2016

      ¡Buenas, Ana!
      Gracias por el vídeo. Yo hice esta entrada porque he oído a tanta gente que cree que sabe de genética pero en realidad no tiene ni idea, que me hundía. No es complicado investigar un poco, pero claro, más fácil es no investigar nada en absoluto.
      ¡Un saludo!

      Me gusta

  3. Manolo (@_artillero)
    septiembre 7, 2016

    Este blog debería ser obligatorio para todos los que queremos escribir ciencia ficción, no hay anda más patético que desarrollar una historia y que nos la tengamos que creer “porque si”, mejor que no le pongan la etiqueta de Scifi y la acomoden en la sección de magia y fantasía. Los grandes autores de ciencia ficción han sido los que se han anticipado y cuyos trabajos ahora son palpables, cotidianos. Felicidades por esta entrada y todas las relacionadas, me recordó a esa hermosa película llamada “Gattaca” que en México le pusieron “Experimento genético”. Saludos.

    Le gusta a 1 persona

    • soyperry
      septiembre 7, 2016

      Buenas 🙂
      Coincido contigo, las historias que intentan ir de ciencia ficción dura y se quedan solo en ficción no me gustan. Siempre siento que el autor no se ha querido esforzar.
      Muchas gracias por tu comentario, un saludo 😀

      Me gusta

  4. Psiquiatraca (@psiquiatraca)
    septiembre 11, 2016

    Wow, muy buena entrada y te felicito porque no has faltado al rigor científico en ningún momento. La genética está avanzando a pasos agigantados y la alteración del genóma será algo habitual no dentro de mucho. Ya existen tratamientos eficaces con terapia génica en la medicina, para tratar canceres, sobre todo leucemias. No sería de extrañar que haya “investigaciones ocultas” gubernamentales con fines militares.

    Me gusta

  5. Pingback: Ciencia para escritores: evitando el dolor | Relatos en la Isla Tintero

  6. Pingback: La teoría del zoo o cómo dudar de la realidad | Relatos en la Isla Tintero

  7. Pingback: Ciencia para escritores: enanos ¿qué tiene de real? | Relatos en la Isla Tintero

  8. Pingback: Recopilación: toda la Ciencia Para Escritores reunida en un solo lugar | Relatos en la Isla Tintero

  9. Pingback: Villanos con ciencia: los efectos de una bomba nuclear | Relatos en la Isla Tintero

  10. Pingback: Los virus son amigos (si sabes cómo tratarlos) | Relatos en la Isla Tintero

  11. Pingback: Una muerte altruista: la apoptosis | Relatos en la Isla Tintero

Responder

Introduce tus datos o haz clic en un icono para iniciar sesión:

Logo de WordPress.com

Estás comentando usando tu cuenta de WordPress.com. Cerrar sesión / Cambiar )

Imagen de Twitter

Estás comentando usando tu cuenta de Twitter. Cerrar sesión / Cambiar )

Foto de Facebook

Estás comentando usando tu cuenta de Facebook. Cerrar sesión / Cambiar )

Google+ photo

Estás comentando usando tu cuenta de Google+. Cerrar sesión / Cambiar )

Conectando a %s

Información

Esta entrada fue publicada en septiembre 1, 2016 por en Ciencia para escritores y etiquetada con , , , .

Contador de visitas

  • 28,565 visitas

Introduce tu dirección de correo electrónico para recibir un email avisándote de cada nueva entrada

Follow me on Twitter

A %d blogueros les gusta esto: